Skip to main content

imarkRoy J. CarverUniversity of Illinois
Biotechnology Center

High-Throughput Sequencing and Genotyping Unit
Director: Alvaro Hernandez Ph. D.
340 Edward R. Madigan Laboratory,
1201 W. Gregory Drive, Urbana, IL 61801
Phone: (217) 244-3480     
FAX: (217) 265-5066
Email: aghernan@illinois.edu 

Services/Equipment

Preparation of 16S (and all other) amplicons for Illumina sequencing

The W.M. Keck Center now offers Fluidigm preparation of custom amplicons! 

Our combined Fluidigm+MiSeq protocol is a cost-effective system allowing researchers to sequence up to 1500 different metagenomic 16S rRNA gene samples (or any other amplicon) against up to 24 different genes/targets, using a streamlined and repeatable microfluidics process that minimizes PCR errors and cross-contamination while maximizing your potential understanding of the mixed communities being studied.

 

How the Fluidigm Platform Works:

                                    Fluidigm

Fluidigm2

Fluidigm Amplicon Design

Fluidigm Design

 

Fluidigm Definitions

 

Common Primers Offered for Amplicon Sequencing

We offer hundreds of different PCR primers for 16S rRNA as well as 18S, eukaryotic, ITS, archaeal, and other functional gene targets.  Our list is continuously being upgraded, so please check with us for the latest primer selections.

Target

Primer Name

Primer Sequence (5' to 3')

Expected FINAL* Product Length (nt)

16S V1-V3

V1-V3 F28

GAGTTTGATCNTGGCTCAG

643

 

V1-V3 R519

GTNTTACNGCGGCKGCTG

 

16S V3-V5

V3-V5 F357

CCTACGGGAGGCAGCAG

694

 

V3-V5 R926

CCGTCAATTCMTTTRAGT

 

16S V4

V4 515F

GTGCCAGCMGCCGCGGTAA

252

 

V4 806R

GGACTACHVGGGTWTCTAAT

 

16S V4 (new) V4 515F (new) GTGYCAGCMGCCGCGGTAA 252
  V4 806R (new) GGACTACNVGGGTWTCTAAT  

Archaea

Arch349F

GYGCASCAGKCGMGAAW

528

 

Arch806R

GGACTACVSGGGTATCTAAT

 

Eukaryotic 18S

F566Euk

CAGCAGCCGCGGTAATTCC

765+

 

R1200Euk

CCCGTGTTGAGTCAAATTAAGC

 

Eukaryotic 18S

Euk_1391F

GTACACACCGCCCGTC

200-280

 

EukBr-7R

TGATCCTTCTGCAGGTTCACCTAC

 

ITS1-ITS4

ITS1

TCCGTAGGTGAACCTGCGG

580+

 

ITS4R

TCCTCCGCTTATTGATATGC

 

ITS3-ITS4

ITS3F

GCATCGATGAAGAACGCAGC

462+

 

ITS4R

TCCTCCGCTTATTGATATGC

 

 

How to Submit Samples for amplification and sequencing on the Fluidigm+MiSeq/HiSeq:

The success of the amplicon construction and sequencing depends heavily on the integrity and purity of the DNA. Degraded or fragmented DNA produces weak amplicons with amplification artifacts. Even if just one of the DNA samples is fragmented, the artifacts produced by amplification can affect the results of the entire pool. DNA with humic acids or other contaminants that interfere with amplification will also produce poor results. Removal of RNA during DNA purification is preferred.

Please, check as many of your DNA samples as possible on a 1% gel and evaluate the integrity of the DNA:

Run an aliquot (~50 to 100ng) of the DNA on a 1% agarose gel next to a DNA ladder.  This picture can be used to evaluate integrity of the DNA as well as presence/absence of RNA.

gel Fluidigm 1

For Fluidigm submission of metagenomic/16S assays we require at least 2 ng/ul quantitated by Qubit or Picogreen.  Submit at least 10 ul of each DNA sample.  Please contact our sister unit, Functional Genomics, for the latest primer information, submission guidelines and submission form.

 

Functional Genomics Unit
Mark Band, Ph.D - Director
356 Edward R. Madigan Laboratory

1201 W. Gregory Drive

Urbana, IL 61801
Phone: (217) 244-3930    FAX: (217) 265-5066    

Email: markband@illinois.edu

The DNA Services lab is available to discuss all sequencing options and pricing (contact information below).

 

MiSeq Pricing Information »

Please contact Dr. Alvaro Hernandez, Director of DNA Services ( aghernan@illinois.edu) at 217-244-3480 or Chris Wright, Assistant Director of DNA Services (clwright@illinois.edu) at 217-333-4372 to discuss ways the staff can be of assistance in achieving your project goals or to receive a quote for your project.

 

 

All work performed by the Roy J. Carver Biotechnology Center (CBC) should be acknowledged in scholarly publications, posters, and presentations. Proper recognition allows us to measure the impact of our work and supports our initiatives in obtaining sponsored funding. In addition, any CBC personnel who make a substantial intellectual or experimental contribution are deserving of further recognition as co-author.