Skip to main content

 

 

Applications

Please, contact us to discuss how we can be of assistance in achieving your project goals or to receive a quote for your project.


Denovo Assembly

 

de novo Assembly

 

De novo genome assembly can be done using several strategies, depending on the genome size, number of samples and desired completeness of the genome.

Eukaryotic genomes:

  1. PacBio Sequel II: This is the latest instrument from PacBio, it produces the longest reads with the highest accuracy versus previous PacBio instruments. It is the instrument of choice for assembly of complex genomes. Also, it is used for characterization of full-length 16S and other amplicons and of full-length transcriptomes (IsoSeq). One SMRT Cell 8M produces 20-30 Gbases of HiFi error-corrected reads with fragments 10-15kb, 150-250+ Gbases of raw reads with fragments 10kb to 50kb, or 3-5 million error corrected cDNA or amplicon reads.

  2. Illumina: Combination of overlapping shotgun libraries that are sequenced with 260bp paired-reads and mate-pair libraries constructed with precise ranges, typically 2-4kb, 5-8kb and 8-12kb. These projects require at least 10μg of high molecular weight (HMW) DNA and are sequenced on a NovaSeq or MiSeq depending on genome size.

  3. Oxford Nanopore GridION: this technology typically produces reads 5kb to 30kb and longer if desired. This is the first choice for full assembly of microbial and fungal genomes. It is also a good choice for scaffolding of large eukaryotic genomes.

  4. 10x Genomics: this technology enables the fast and low cost assembly of genomes by barcoding long molecules of DNA, preparing shotgun libraries and then reassembling the long molecules using those barcodes (see description here). Assembly is done with SuperNova 2.0.

10x Genomics Genome Application
10x Genomics workflow


Denovo Assembly

Genome Resequencing and skim-seq

 

For this application, we construct PCR-free or shotgun libraries with 3-4 cycles of PCR if enough DNA is not available. The libraries are barcoded with Unique Dual Indexes (UDIs) to prevent index switching and have fragments with an average length of 450bp. Each sample is sequenced to the desired depth (from 1x to 100x or more) on a NovaSeq or MiSeq depending on genome size, number of samples and desired genome coverage. Skim-seq libraries are less efficient at amplifying the entire genome but are significantly cheaper and allow for genotyping of a large number of samples at a reasonable cost. 


Denovo Assembly

 

RNA-Seq and Small RNA

 

There are several options for RNA-Seq and small RNA libraries:

RNA-Seq, Eukaryotic species:

mRNA-enriched: constructed with the TruSeq mRNA library prep kit with Unique Dual Indexes to prevent index switching. Libraries are made by first selecting polyA RNAs, converting the RNAs to cDNA, performing adaptor ligation and amplifying for the minimum number of PCR cycles required.  At least 50ng of total RNA having a RIN > 7 and free from contaminating DNA should be submitted.

rRNA-depleted: for characterization of polyA+ and polyA- genes, libraries can be constructed by depleting rRNA and converting the leftover RNA to cDNA, instead of capturing polyA+ mRNAs.

FFPE samples: RNA-Seq libraries can be constructed from degraded and very low amounts of RNA by first converting all the RNA to cDNA and then using specific probes to remove rRNA.

RNAseq, Microbial and Metagenomic samples:

rRNA-depletion: removal of rRNA can be done with probes that remove microbial rRNAs or with probes that remove both host and microbial rRNAs. The leftover RNA is converted to RNA-Seq libraries that are individually barcoded with Unique Dual Indexes.

Small RNA, Eukaryotic species:

Libraries are constructed from 10ng of enriched small RNA fraction or 100ng of total RNA. RNAs from 15nt to 30nt in length are enriched by size selection on a PAGE gel.

Small RNA, bacterial:

Total RNA is treated with Antarctic Phosphatase and PNK, adaptors are added and RNAs 15nt to 250nt are enriched by size selection on a PAGE gel. 

rnaseq
Tissue-Specific Expression Detected with RNA-SEQ


Denovo Assembly

 

Epigenetics

 

ChIP-Seq:

 The critical parameters for these libraries are:

  1. The input DNA must be sheared to a size between 100bp and 600bp prior to pull down. We get consistent results using Covaris sonicators. Ideal sonication times need to be validated for different cell types and range from 10 min to 35 min. After sonication of a test cell suspension, please purify an aliquot of the cells and run the DNA on a 1% or 2% agarose gel with appropriately sized DNA ladder to confirm that the DNA is between 100bp and 600bp. Longer DNAs do not sequence well are most likely not efficiently enriched.
  2. After immunoprecipitation, we strongly recommend to confirm enrichment by performing qPCR of positive control regions relative to negative control regions before submitting DNA for library construction. A collection of ChIP-Seq data is available at the encode webpage, where the peaks can be visualized on the genome browser and primers can be designed from your genomic regions of interest. A database of primers for many common targets can be found here.

Bisulfite-treated DNA:

Libraries can be constructed from the whole genome (Whole Genome Bisulfite Sequencing or WGBS) or from areas of the genome that have high CpG content (Reduced Representation Bisulfite Sequencing or RRBS). WGBS libraries are typically sequenced to a depth of at least 10X, while RRBS libraries typically capture only 1% of the genome so they need a much lower sequencing depth compared to WGBS.

 

ATAC-Seq, MeDIP, Cut&Run:

These custom libraries are typically constructed by the user in their lab. However, we recommend discussing your application with us prior to library constuction to ensure that final libraries will be compatible with the latest sequencing technology. 

allamy

 

Denovo Assembly

 

Long Reads for de novo Assembly and Genome Phasing

 

There are three technologies available in our facility for sequencing and assembly of long reads and for genome phasing:

  1. PacBio Sequel II: This is the latest instrument from PacBio, it produces the longest reads with the highest accuracy versus previous PacBio instruments. It is the instrument of choice for assembly of complex genomes. Also, it is used for characterization of full-length 16S and other amplicons and of full-length transcriptomes (IsoSeq). One SMRT Cell 8M produces 20-30 Gbases of HiFi error-corrected reads with fragments 10-15kb, 150-250+ Gbases of raw reads with fragments 10kb to 50kb, or 3-5 million error corrected cDNA or amplicon reads.
  2. 10x Genomics de novo assembly and/or phasing: This technology begins with high molecular weight (HMW) DNA, ideally in fragments at least 50kb or greater. It then partitions the HMW DNA fragments into micelles, along with an adapter molecule and a barcode. All the DNA fragments within an individual micelle get barcoded with the same barcode. Fragments are then pooled and converted into a standard shotgun library and sequenced on an Illumina NovaSeq. The 10x software Supernova is then run to reassemble the original molecules based on the barcodes. The de novo assembled molecules can also be used for phasing of the genome and discovery of short and large structural variants, including SNPs. See more information here.
  3. Oxford Nanopore GridION x5: This technology typically produces reads 5kb to 30kb and longer if desired, and is the first choice for full assembly of microbial and fungal genomes. It is also a good choice for scaffolding of large eukaryotic genomes.

 

10x Genomics Phased Assembly
10x Genomics phased assembly

 

 


Denovo Assembly

 

Single Cell Transcriptomics and Spatial Transcriptomics

 

Single Cell Gene Expression with the 10x Genomics Chromium: Single cells from any eukaryotic species can be processed with this technology, as long as the cells are < 40uM in diameter. This technology begins with single-cells with > 70% viability. It then partitions the single cells into micelles, along with an adapter molecule and a barcode enclosed within a gel bead. All the mRNAs from a single-cell within an individual micelle get barcoded with the same barcode. mRNAs are then converted to cDNAs, pooled, converted into an Illumina library and sequenced on a NovaSeq to get at least 50,000 reads per cell. Sequencing requires 28 cycles for read1 (barcode) and 98 cycles for read2 (cDNA). Typically this is performed on a 2x100nt or 2x150nt paired-end lane. Read more about what you can do with 10x Genomics here.

The software Cell Ranger is utilized to align the reads to the appropriate annotated genome/transcriptome and generate gene counts and other features. 

Please see the 10x Submission Guidelines for important submission information, protocols, and tips.

singlecellworkflow
Single Cell Workflow
singlecell2
Cell clusters based on gene expression

 

10x Visium Spatial Transcriptomics: Available now, please contact us!  The 10x Visium Spatial platform allows researchers to generate spatially resolved gene expression data directly from fresh frozen tissue sections. Tissue sections are first H&E stained and images captured, then the same tissue section is permeabalized to release mRNA onto capture spots that contain spatially barcoded oligos fixed to the slide.  mRNAs are converted to cDNAs and then collected for dual-indexed Illumina library construction and sequencing.  The H&E stained image and the spatially barcoded cDNAs are overlaid to allow visualization of the gene expression within the original tissue placement.

Please see the 10x Visium page for important submission information, protocols, and tips.

Resolve Complexity with Spatial Transcriptomics
Resolve Complexity with Spatial Transcriptomics
The Visium Workflow
The 10x Visium workflow

 


Genotyping

 

Genotyping

Targeted genotyping, using primers to amplify specific regions of the genome, is accomplished in our facility using the Fluidigm system, a streamlined and repeatable micro-fluidics process that minimizes PCR errors and cross-contamination. This system allows for processing up to 1,500 different samples with up to 48 primer pairs targeting known regions of the genome. We also have extensive experience sequencing GBS and RAD-Seq libraries prepared by our users.

Skim-seq libraries and sequencing is another cost effective way to sequence entire genomes for genotyping at a reasonable cost. 


Metagenomcs

 

Metagenomics/16S

 

There are several approaches for the characterization of microbial communities to answer the questions "who is there?", "what are they doing?" and "what are they doing right now?". These involve strategies to characterize the microbes present in the community, the genes that are present in the community, and the genes that are being expressed under different conditions.

  1. Whole Genome Sequencing: preparation of shotgun libraries and deep sequencing. The depth of sequencing depends on the expected diversity of the community. We offer low cost methods for the processing of hundreds or thousands of samples and sequencing on the NovaSeq or MiSeq.

  2. 16S rDNA regions and other loci: Our combined Fluidigm+MiSeq protocol is a cost-effective system allowing researchers to sequence PCR products from up to 1500 different metagenomic samples utilizing up to 24 different genes/targets (eg: 16S for bacteria, 16S for archaea, ITS, 18S, and functional genes of interest).  We use a streamlined and repeatable micro-fluidics process that minimizes PCR errors and cross-contamination while maximizing your potential understanding of the mixed communities being studied (see Figure 2 below).

  3. **Full-length 16S and other amplicons with PacBio**: amplification of the entire 16S gene with the primers AGRGTTYGATYMTGGCTCAG (forward) and RGYTACCTTGTTACGACTT (reverse) produces full length 16S amplicons for sequencing on the PacBio. These amplicons are sequenced with the HiFi mode, which produces amplicons with 99.999% accuracy. Analysis of full-length amplicons produces a more accurate view of the metagenomics community and higher % of classifications to the species level compared to sequencing 16S variable regions.

  4. Metatranscriptomics: expressed genes from a metagenomics community can be characterized with RNA-Seq libraries. For this, rRNAs from microbes or from microbes+host are removed with Ribozero or custom probes and RNA-Seq libraries are constructed from the leftover RNA, which contains the expressed genes.

metagenomics
Fig. 1: Metagenomics
Fluidigm2
Fig 2: Fluidigm Access Array Plate Setup
 

Common Primers Offered for Amplicon Sequencing of 16S regions and other targets

We offer hundreds of different PCR primers for 16S rRNA as well as 18S, eukaryotic, ITS, archaeal, and other functional gene targets. Our list is continuously being expanded, so please check with us for the latest primer selections.

Target

Primer Name

Primer Sequence (5' to 3')

Expected FINAL*
Product Length (nt)

16S V1-V3

V1-V3 F28

GAGTTTGATCNTGGCTCAG

643

 

V1-V3 R519

GTNTTACNGCGGCKGCTG

 

16S V3-V5

V3-V5 F357

CCTACGGGAGGCAGCAG

694

 

V3-V5 R926

CCGTCAATTCMTTTRAGT

 

16S V4

V4 515F

GTGCCAGCMGCCGCGGTAA

252

 

V4 806R

GGACTACHVGGGTWTCTAAT

 

16S V4 (new) V4 515F (new) GTGYCAGCMGCCGCGGTAA 252
  V4 806R (new) GGACTACNVGGGTWTCTAAT  

Archaea

Arch349F

GYGCASCAGKCGMGAAW

528

 

Arch806R

GGACTACVSGGGTATCTAAT

 

Eukaryotic 18S

F566Euk

CAGCAGCCGCGGTAATTCC

765+

 

R1200Euk

CCCGTGTTGAGTCAAATTAAGC

 

Eukaryotic 18S

Euk_1391F

GTACACACCGCCCGTC

200-280

 

EukBr-7R

TGATCCTTCTGCAGGTTCACCTAC

 

ITS1-ITS4

ITS1

TCCGTAGGTGAACCTGCGG

580+

 

ITS4R

TCCTCCGCTTATTGATATGC

 

ITS3-ITS4

ITS3F

GCATCGATGAAGAACGCAGC

462+

 

ITS4R

TCCTCCGCTTATTGATATGC

 

How to Submit Samples for amplification and sequencing on the Fluidigm+MiSeq/NovaSeq:

The success of the amplicon construction and sequencing depends heavily on the integrity and purity of the DNA. Degraded or fragmented DNA produces weak amplicons with amplification artifacts. Even if just one of the DNA samples is fragmented, the artifacts produced by amplification can affect the results of the entire pool. DNA with humic acids or other contaminants that interfere with amplification will also produce poor results. Removal of RNA during DNA purification is preferred.

Please, check as many of your DNA samples as possible on a 1% gel to evaluate the integrity of the DNA:

Run an aliquot (~50 to 100ng) of the DNA on a 1% agarose gel next to an appropriate DNA ladder. This picture can be used to evaluate integrity of the DNA as well as presence/absence of RNA.

For Fluidigm submission of metagenomic/16S assays we require at least 2 ng/ul quantitated by Qubit or Picogreen. Submit at least 10 ul of each DNA sample. Please contact our sister unit, Functional Genomics, for the latest primer information, submission guidelines and submission form.

The DNA Services lab is available to discuss all sequencing options and pricing (contact information below).


Denovo Assembly

Exome and other Targeted Sequencing

 

Specific regions of the genome, such as the exomes or other regions of interest, can be captured by shearing genomic DNA and pulling down those regions of interest with biotinylated probes. The enriched fragments are then adaptored to construct individually barcoded Illumina libraries. Genomic probes can be synthesized for any species with a draft reference genome.


Denovo AssemblyCore Fragment Analysis and Sanger Sequencing

 

Please visit our CoreLims website (unicorn.biotec.illinois.edu) to submit your fragment analysis orders and low- and medium-throughtput Sanger sequencing orders.

The Core Facility provides Sanger DNA sequencing and fragment analysis services to researchers at domestic and international academic institutions, government agencies and private companies. All sequencing and fragment analysis samples are analyzed on two Applied Biosystems 3730xl DNA Analyzers. These automated sequencers run with 50cm capillary arrays and are extremely fast and accurate.

We offer two levels of pricing, based on the number of samples in your project and the way you submit them.

  • Low-throughput: 1-95 sequencing reactions submitted at any one time in 1.5 ml tubes.
  • High-throughput: 1 or more 96-well plates of sequencing reactions submitted at any one time.

Our CoreLims website (unicorn.biotec.illinois.edu) is used to submit and track Fragment Analysis and Sanger sequencing orders, retrieve data, gain access to analysis software and obtain troubleshooting assistance.

Customers are encouraged to discuss any problems or concerns with facility personnel, as our goal is to provide only the highest-quality sequencing data and support. For consultations, please contact the Core staff at dna-seq@illinois.edu or 217-333-9520.